1
artículo
Publicado 2018
Enlace
Enlace
The present study aimed to detect a protein associated with acute hepatopancreatic necrosis (AHPND) by mass spectrometry, reared under semi-intensive farming in Ecuador. Sick shrimps from three farms were collected in the Bellavista area in the El Oro province. The hepatopancreas were macerated and cultured in TCBS medium and subcultured in TSA and LB broth. In the bacterial strains obtained, the proteins were extracted using a commercial kit and separated by SDS-PAGE gel migration. These were analyzed with a MALDI TOF/TOF mass spectrometer. The confirmation of the strains was performed by PCR using TUMSAT-Vp3 primers, which are specific for detecting AHPND. One of the strains had peptide sequences similar to that of the PirvpB protein causing AHPND, and was identified as belonging to Vibrio parahaemolyticus and carrying the gene coding for PirvpB. The results showed that it is possible ...
2
artículo
Publicado 2018
Enlace
Enlace
The present study aimed to detect a protein associated with acute hepatopancreatic necrosis (AHPND) by mass spectrometry, reared under semi-intensive farming in Ecuador. Sick shrimps from three farms were collected in the Bellavista area in the El Oro province. The hepatopancreas were macerated and cultured in TCBS medium and subcultured in TSA and LB broth. In the bacterial strains obtained, the proteins were extracted using a commercial kit and separated by SDS-PAGE gel migration. These were analyzed with a MALDI TOF/TOF mass spectrometer. The confirmation of the strains was performed by PCR using TUMSAT-Vp3 primers, which are specific for detecting AHPND. One of the strains had peptide sequences similar to that of the PirvpB protein causing AHPND, and was identified as belonging to Vibrio parahaemolyticus and carrying the gene coding for PirvpB. The results showed that it is possible ...
3
tesis de grado
Publicado 2012
Enlace
Enlace
La presente investigación se realizó del 5 de diciembre del 2011 al 20 de marzo del 2012 en el Laboratorio de Biología Molecular de la Facultad de Ingeniería Pesquera de la Universidad Nacional de Tumbes. Se pretendió determinar si los primers diseñados para PCR: CXcFw1 (CGGAAGGCAGCAGTAGGG) /CXcRev3 (CCGGGACTTTTTCTGTGGG) y nested-PCR: CxcFw1 (CGGAAGGCAGCAGTAGGG)/CXcRev4 (TATCTAAT CCTGTTTGCTCCCC) y CXcFw1/CXcRev2 (CGGAAGGCAGCAGTAGGG/ ACTTACTAAACCACCTACACACCC) permitirían detectar un fragmento del gen 16S ARNr en rickettsias en Crassostrea gigas. Para ello se realizó la extracción de ADN de muestras de branquias y masa visceral de C. gigas siguiendo el protocolo CTAB y para verificar la extracción adecuada se realizó una amplificación del gen de referencia de actina mediante PCR utilizando los primers Bi-actin-Fw y Bi-actin-Rev. Los resultados indican que la extracción de ADN ...
4
tesis de maestría
Publicado 2016
Enlace
Enlace
El cultivo de Litopenaeus vananmei, se ha convertido en una de las principales producciones acuícolas a nivel mundial. Sin embargo, enfermedades infecciosas bacterianas y virales causan mortalidades epidémicas o endémicas desestabilizando la rentabilidad, sostenibilidad y desarrollo de esta actividad acuícola. En el presente trabajo se investigó la microbiota de la hemolinfa en langostinos L. vannamei sanos o enfermos, considerando tecnologías de caracterización molecular dependientes e independientes de cultivo in vitro. Se trata entonces, por una parte, de bacterias cultivadas in vitro de manera aislada y luego identificadas molecularmente y, por otra parte, de bacterias co-cultivadas in vitro y de bacterias de la hemolinfa, siendo la composición bacteriana establecida por metagenómica dirigida al ADNr. En lo que concierne las bacterias cultivables in vitro aisladamente, predo...
5
artículo
Publicado 2018
Enlace
Enlace
El cangrejo del manglar Ucides occidentalis es una especie clave en el manglar pues recicla hasta el 84% de su hojarasca, así también es el cangrejo más explotado en la región Tumbes, tanto así que su población se ha reducido drásticamente, hasta 35,8% en 11 años, esta situación puede llevar a que se necesite hacer su repoblamiento, el que para ser adecuadamente realizado requiere del conocimiento de su genética poblacional. En esta investigación se buscó determinar la diversidad genética de U. occidentalis en el manglar de Tumbes, en base al estudio de un fragmento del gen 16S ARNr. De 38 muestras de ADN de U. occidentalis recolectados del manglar de Tumbes, se amplificó y secuenció fragmentos del gen 16S ARNr, los que al ser analizados indicaron polimorfismo (tasa de polimorfismo de 52,64%), una alta diversidad genética (indicada por el alto número de haplotipos: 16 ...
6
artículo
Publicado 2018
Enlace
Enlace
El cangrejo del manglar Ucides occidentalis es una especie clave en el manglar pues recicla hasta el 84% de su hojarasca, así también es el cangrejo más explotado en la región Tumbes, tanto así que su población se ha reducido drásticamente, hasta 35,8% en 11 años, esta situación puede llevar a que se necesite hacer su repoblamiento, el que para ser adecuadamente realizado requiere del conocimiento de su genética poblacional. En esta investigación se buscó determinar la diversidad genética de U. occidentalis en el manglar de Tumbes, en base al estudio de un fragmento del gen 16S ARNr. De 38 muestras de ADN de U. occidentalis recolectados del manglar de Tumbes, se amplificó y secuenció fragmentos del gen 16S ARNr, los que al ser analizados indicaron polimorfismo (tasa de polimorfismo de 52,64%), una alta diversidad genética (indicada por el alto número de haplotipos: 16 ...
7
artículo
Publicado 2020
Enlace
Enlace
The tidal channels in the department of Tumbes, Peru harbor various species of penaeids, such as Penaeus stylirostris and P. vannamei, the latter of great economic importance for the country. In 2017, 560 specimens of wild prawns were evaluated in two sampling periods (May-June and September-November), from seven tidal channels to determine the prevalence of notifiable diseases: White Spot Syndrome (WSSV), Infectious Hypodermal and Hematopoietic Infection (IHHNV), Hepatopancreatic Necrosis (NHP), Taura Syndrome (TSV), Infectious Myonecrosis (IMNV) and Yellow Head Syndrome (YHV) using the PCR technique. The presence of three of the seven pathogens was detected. The highest prevalence of the study was VNHHI (6.35%) distributed in the seven tidal channels, followed by HPN (2.65%) in five tidal channels and VSMB (0.55%) present in three channels, but only in the first sampling period.
8
artículo
Publicado 2020
Enlace
Enlace
The tidal channels in the department of Tumbes, Peru harbor various species of penaeids, such as Penaeus stylirostris and P. vannamei, the latter of great economic importance for the country. In 2017, 560 specimens of wild prawns were evaluated in two sampling periods (May-June and September-November), from seven tidal channels to determine the prevalence of notifiable diseases: White Spot Syndrome (WSSV), Infectious Hypodermal and Hematopoietic Infection (IHHNV), Hepatopancreatic Necrosis (NHP), Taura Syndrome (TSV), Infectious Myonecrosis (IMNV) and Yellow Head Syndrome (YHV) using the PCR technique. The presence of three of the seven pathogens was detected. The highest prevalence of the study was VNHHI (6.35%) distributed in the seven tidal channels, followed by HPN (2.65%) in five tidal channels and VSMB (0.55%) present in three channels, but only in the first sampling period.